Review



instant sticky end ligase master mix  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    New England Biolabs instant sticky end ligase master mix
    Instant Sticky End Ligase Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 206 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/instant+sticky+end+ligase+master+mix/Instant+Sticky-end+Ligase+Master+Mix/pmc13112749-382-7-12
    Average 97 stars, based on 206 article reviews
    instant sticky end ligase master mix - by Bioz Stars, 2026-09
    97/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Targeted, long-read nucleic acid sequencing for the determination of cytosine modifications
    Article Snippet: .. SMRT Sequencing 4 kb model DNA lrTAPS product was double-digested by BstAPI restriction enzyme (NEB) then ligated with modified SMRTbell adaptor (IDT, sequence 5′ to 3′/5Phos/GTAGTCTCGCACAGATATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTT GAGAGAGATATCTGTGCGAGACTACAGT (SEQ ID NO:24), extra AGT overhang was added for the stick-end ligation) by Instant Sticky-end Ligase Master Mix (NEB). .. SMRTbell Template Prep Kit 1.0 (Pacbio) and standard 16-base barcode SMRTbell adaptors (IDT) were used for library preparation of lambda DNA, mESCs and HBV samples.

    Modification:

    Article Title: Targeted, long-read nucleic acid sequencing for the determination of cytosine modifications
    Article Snippet: .. SMRT Sequencing 4 kb model DNA lrTAPS product was double-digested by BstAPI restriction enzyme (NEB) then ligated with modified SMRTbell adaptor (IDT, sequence 5′ to 3′/5Phos/GTAGTCTCGCACAGATATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTT GAGAGAGATATCTGTGCGAGACTACAGT (SEQ ID NO:24), extra AGT overhang was added for the stick-end ligation) by Instant Sticky-end Ligase Master Mix (NEB). .. SMRTbell Template Prep Kit 1.0 (Pacbio) and standard 16-base barcode SMRTbell adaptors (IDT) were used for library preparation of lambda DNA, mESCs and HBV samples.

    Ligation:

    Article Title: Targeted, long-read nucleic acid sequencing for the determination of cytosine modifications
    Article Snippet: .. SMRT Sequencing 4 kb model DNA lrTAPS product was double-digested by BstAPI restriction enzyme (NEB) then ligated with modified SMRTbell adaptor (IDT, sequence 5′ to 3′/5Phos/GTAGTCTCGCACAGATATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTT GAGAGAGATATCTGTGCGAGACTACAGT (SEQ ID NO:24), extra AGT overhang was added for the stick-end ligation) by Instant Sticky-end Ligase Master Mix (NEB). .. SMRTbell Template Prep Kit 1.0 (Pacbio) and standard 16-base barcode SMRTbell adaptors (IDT) were used for library preparation of lambda DNA, mESCs and HBV samples.

    Article Title: Enhancing CRISPR-Cas12a base editing in plants with LbCas12a variants and introns.
    Article Snippet: .. The six crRNA cassettes were combined by enzymatic digestion and ligation using NcoI/SpeI‐linearized pYPQ142‐AtUBQ10‐crRNAs and NcoI/XbaI‐linearized pYPQ144‐crRNAs with the Instant Sticky‐End Ligase Master Mix (New England Biolabs). ..

    Article Title: Highly efficient chromatin conformation capture with post-enrichment in single cells by HiChew
    Article Snippet: .. For ligation, 220 μL of 2 × Instant Sticky-End Ligase Master Mix (New England Biolabs, Cat. No. M0370), 352 μL of 5 × Quick Ligase Buffer (New England Biolabs, Cat. No. B6058S), and 132 μL of 1,2-propanediol (Sigma-Aldrich, Cat. No. 398039) were mixed and 6.4 μL of mixture was distributed into each well of the plate containing the nuclei and adapters. ..

    Polymerase Chain Reaction:

    Article Title: Zinc Finger Homeobox Transcription Factors OsMIF1 and OsMIF2 Regulate Grain Size and Panicle Development in Rice
    Article Snippet: .. The PCR product was purified, digested with EcoRI-HF (Cat. #R3101, New England Biolabs, Ipswich, MA, USA) and NcoI-HF (Cat. #R3193, New England Biolabs, Ipswich, MA, USA), and ligated into the pCAMBIA1201 vector that had been digested with the same enzymes, using Instant Sticky-end Ligase Master Mix (Cat. #M0370, New England Biolabs, Ipswich, MA, USA), according to the manufacturer’s protocol. ..

    Article Title: Zinc Finger Homeobox Transcription Factors OsMIF1 and OsMIF2 Regulate Grain Size and Panicle Development in Rice.
    Article Snippet: .. The PCR product was purified, digested with EcoRIHF (Cat. #R3101, New England Biolabs, Ipswich, MA, USA) and NcoI-HF (Cat. #R3193, New England Biolabs, Ipswich, MA, USA), and ligated into the pCAMBIA1201 vector that had been digested with the same enzymes, using Instant Sticky-end Ligase Master Mix (Cat. #M0370, New England Biolabs, Ipswich, MA, USA), according to the manufacturer’s protocol. ..

    Article Title: Zinc Finger Homeobox Transcription Factors OsMIF1 and OsMIF2 Regulate Grain Size and Panicle Development in Rice
    Article Snippet: .. The PCR product and the p35S-RED-NOS vector were digested with BamHI-HF (Cat. # R3136, New England Biolabs, Ipswich, MA, USA) and KpnI-HF (Cat. # R3142, New England Biolabs, Ipswich, MA, USA), and ligated using the Instant Sticky End Ligase Master Mix (Cat. #M0370, New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions to generate the OsMIF1–RFP fusion construct. ..

    Purification:

    Article Title: Zinc Finger Homeobox Transcription Factors OsMIF1 and OsMIF2 Regulate Grain Size and Panicle Development in Rice
    Article Snippet: .. The PCR product was purified, digested with EcoRI-HF (Cat. #R3101, New England Biolabs, Ipswich, MA, USA) and NcoI-HF (Cat. #R3193, New England Biolabs, Ipswich, MA, USA), and ligated into the pCAMBIA1201 vector that had been digested with the same enzymes, using Instant Sticky-end Ligase Master Mix (Cat. #M0370, New England Biolabs, Ipswich, MA, USA), according to the manufacturer’s protocol. ..

    Article Title: Zinc Finger Homeobox Transcription Factors OsMIF1 and OsMIF2 Regulate Grain Size and Panicle Development in Rice.
    Article Snippet: .. The PCR product was purified, digested with EcoRIHF (Cat. #R3101, New England Biolabs, Ipswich, MA, USA) and NcoI-HF (Cat. #R3193, New England Biolabs, Ipswich, MA, USA), and ligated into the pCAMBIA1201 vector that had been digested with the same enzymes, using Instant Sticky-end Ligase Master Mix (Cat. #M0370, New England Biolabs, Ipswich, MA, USA), according to the manufacturer’s protocol. ..

    Plasmid Preparation:

    Article Title: Zinc Finger Homeobox Transcription Factors OsMIF1 and OsMIF2 Regulate Grain Size and Panicle Development in Rice
    Article Snippet: .. The PCR product was purified, digested with EcoRI-HF (Cat. #R3101, New England Biolabs, Ipswich, MA, USA) and NcoI-HF (Cat. #R3193, New England Biolabs, Ipswich, MA, USA), and ligated into the pCAMBIA1201 vector that had been digested with the same enzymes, using Instant Sticky-end Ligase Master Mix (Cat. #M0370, New England Biolabs, Ipswich, MA, USA), according to the manufacturer’s protocol. ..

    Article Title: Zinc Finger Homeobox Transcription Factors OsMIF1 and OsMIF2 Regulate Grain Size and Panicle Development in Rice.
    Article Snippet: .. The PCR product was purified, digested with EcoRIHF (Cat. #R3101, New England Biolabs, Ipswich, MA, USA) and NcoI-HF (Cat. #R3193, New England Biolabs, Ipswich, MA, USA), and ligated into the pCAMBIA1201 vector that had been digested with the same enzymes, using Instant Sticky-end Ligase Master Mix (Cat. #M0370, New England Biolabs, Ipswich, MA, USA), according to the manufacturer’s protocol. ..

    Article Title: Strain level variation in Proteus mirabilis chondroitin sulfate degradation kinetics and regulation by urea
    Article Snippet: .. Upstream amplicons were then digested with FastDigest restriction enzymes SalI and EcoRI, downstream amplicons were digested with FastDigest SacI and EcoRI, and the pDM4 vector was digested with SalI and SacI (ThermoFisher Scientific), for one hour and then ligated using Instant Sticky-end Ligase Master Mix (NEB) before being electroporated into E. coli S17 λpir. ..

    Construct:

    Article Title: Zinc Finger Homeobox Transcription Factors OsMIF1 and OsMIF2 Regulate Grain Size and Panicle Development in Rice
    Article Snippet: .. The PCR product and the p35S-RED-NOS vector were digested with BamHI-HF (Cat. # R3136, New England Biolabs, Ipswich, MA, USA) and KpnI-HF (Cat. # R3142, New England Biolabs, Ipswich, MA, USA), and ligated using the Instant Sticky End Ligase Master Mix (Cat. #M0370, New England Biolabs, Ipswich, MA, USA) according to the manufacturer’s instructions to generate the OsMIF1–RFP fusion construct. ..



    Similar Products

    97
    New England Biolabs instant sticky end ligase master mix
    Instant Sticky End Ligase Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/instant+sticky+end+ligase+master+mix/Instant+Sticky-end+Ligase+Master+Mix/pmc13112749-382-7-12
    Average 97 stars, based on 1 article reviews
    instant sticky end ligase master mix - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    Image Search Results