instant sticky end ligase master mix (New England Biolabs)
97
Structured Review
New England Biolabs
instant sticky end ligase master mix
Instant Sticky End Ligase Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 206 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/instant+sticky+end+ligase+master+mix/Instant+Sticky-end+Ligase+Master+Mix/pmc13112749-382-7-12
Average 97 stars, based on 206 article reviews
Instant Sticky End Ligase Master Mix, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 206 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/instant+sticky+end+ligase+master+mix/Instant+Sticky-end+Ligase+Master+Mix/pmc13112749-382-7-12
Average 97 stars, based on 206 article reviews
instant sticky end ligase master mix - by Bioz Stars,
2026-09
97/100 stars
Images
Related Articles
Sequencing:Article Title: Targeted, long-read nucleic acid sequencing for the determination of cytosine modifications Article Snippet: .. SMRT Sequencing 4 kb model DNA lrTAPS product was double-digested by BstAPI restriction enzyme (NEB) then ligated with modified SMRTbell adaptor (IDT, sequence 5′ to 3′/5Phos/GTAGTCTCGCACAGATATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTT GAGAGAGATATCTGTGCGAGACTACAGT (SEQ ID NO:24), extra AGT overhang was added for the stick-end ligation) by Modification:Article Title: Targeted, long-read nucleic acid sequencing for the determination of cytosine modifications Article Snippet: .. SMRT Sequencing 4 kb model DNA lrTAPS product was double-digested by BstAPI restriction enzyme (NEB) then ligated with modified SMRTbell adaptor (IDT, sequence 5′ to 3′/5Phos/GTAGTCTCGCACAGATATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTT GAGAGAGATATCTGTGCGAGACTACAGT (SEQ ID NO:24), extra AGT overhang was added for the stick-end ligation) by Ligation:Article Title: Targeted, long-read nucleic acid sequencing for the determination of cytosine modifications Article Snippet: .. SMRT Sequencing 4 kb model DNA lrTAPS product was double-digested by BstAPI restriction enzyme (NEB) then ligated with modified SMRTbell adaptor (IDT, sequence 5′ to 3′/5Phos/GTAGTCTCGCACAGATATCTCTCTCTTTTCCTCCTCCTCCGTTGTTGTTGTT GAGAGAGATATCTGTGCGAGACTACAGT (SEQ ID NO:24), extra AGT overhang was added for the stick-end ligation) by Article Title: Enhancing CRISPR-Cas12a base editing in plants with LbCas12a variants and introns. Article Snippet: .. The six crRNA cassettes were combined by enzymatic digestion and ligation using NcoI/SpeI‐linearized pYPQ142‐AtUBQ10‐crRNAs and NcoI/XbaI‐linearized pYPQ144‐crRNAs with the Article Title: Highly efficient chromatin conformation capture with post-enrichment in single cells by HiChew Article Snippet: .. For ligation, 220 μL of 2 × Polymerase Chain Reaction:Article Title: Zinc Finger Homeobox Transcription Factors OsMIF1 and OsMIF2 Regulate Grain Size and Panicle Development in Rice Article Snippet: .. The PCR product was purified, digested with EcoRI-HF (Cat. #R3101, New England Biolabs, Ipswich, MA, USA) and NcoI-HF (Cat. #R3193, New England Biolabs, Ipswich, MA, USA), and ligated into the pCAMBIA1201 vector that had been digested with the same enzymes, using Article Title: Zinc Finger Homeobox Transcription Factors OsMIF1 and OsMIF2 Regulate Grain Size and Panicle Development in Rice. Article Snippet: .. The PCR product was purified, digested with EcoRIHF (Cat. #R3101, New England Biolabs, Ipswich, MA, USA) and NcoI-HF (Cat. #R3193, New England Biolabs, Ipswich, MA, USA), and ligated into the pCAMBIA1201 vector that had been digested with the same enzymes, using Article Title: Zinc Finger Homeobox Transcription Factors OsMIF1 and OsMIF2 Regulate Grain Size and Panicle Development in Rice Article Snippet: .. The PCR product and the p35S-RED-NOS vector were digested with BamHI-HF (Cat. # R3136, New England Biolabs, Ipswich, MA, USA) and KpnI-HF (Cat. # R3142, New England Biolabs, Ipswich, MA, USA), and ligated using the Purification:Article Title: Zinc Finger Homeobox Transcription Factors OsMIF1 and OsMIF2 Regulate Grain Size and Panicle Development in Rice Article Snippet: .. The PCR product was purified, digested with EcoRI-HF (Cat. #R3101, New England Biolabs, Ipswich, MA, USA) and NcoI-HF (Cat. #R3193, New England Biolabs, Ipswich, MA, USA), and ligated into the pCAMBIA1201 vector that had been digested with the same enzymes, using Article Title: Zinc Finger Homeobox Transcription Factors OsMIF1 and OsMIF2 Regulate Grain Size and Panicle Development in Rice. Article Snippet: .. The PCR product was purified, digested with EcoRIHF (Cat. #R3101, New England Biolabs, Ipswich, MA, USA) and NcoI-HF (Cat. #R3193, New England Biolabs, Ipswich, MA, USA), and ligated into the pCAMBIA1201 vector that had been digested with the same enzymes, using Plasmid Preparation:Article Title: Zinc Finger Homeobox Transcription Factors OsMIF1 and OsMIF2 Regulate Grain Size and Panicle Development in Rice Article Snippet: .. The PCR product was purified, digested with EcoRI-HF (Cat. #R3101, New England Biolabs, Ipswich, MA, USA) and NcoI-HF (Cat. #R3193, New England Biolabs, Ipswich, MA, USA), and ligated into the pCAMBIA1201 vector that had been digested with the same enzymes, using Article Title: Zinc Finger Homeobox Transcription Factors OsMIF1 and OsMIF2 Regulate Grain Size and Panicle Development in Rice. Article Snippet: .. The PCR product was purified, digested with EcoRIHF (Cat. #R3101, New England Biolabs, Ipswich, MA, USA) and NcoI-HF (Cat. #R3193, New England Biolabs, Ipswich, MA, USA), and ligated into the pCAMBIA1201 vector that had been digested with the same enzymes, using Article Title: Strain level variation in Proteus mirabilis chondroitin sulfate degradation kinetics and regulation by urea Article Snippet: .. Upstream amplicons were then digested with FastDigest restriction enzymes SalI and EcoRI, downstream amplicons were digested with FastDigest SacI and EcoRI, and the pDM4 vector was digested with SalI and SacI (ThermoFisher Scientific), for one hour and then ligated using Construct:Article Title: Zinc Finger Homeobox Transcription Factors OsMIF1 and OsMIF2 Regulate Grain Size and Panicle Development in Rice Article Snippet: .. The PCR product and the p35S-RED-NOS vector were digested with BamHI-HF (Cat. # R3136, New England Biolabs, Ipswich, MA, USA) and KpnI-HF (Cat. # R3142, New England Biolabs, Ipswich, MA, USA), and ligated using the |